Cat #: 11-733A
Zymo Research D6426 Quick-ITS Plus NGS Library Prep Kit, Microbiomics, 24 Reactions/Unit
Cat #: 11-733A
Zymo Research D6426 Quick-ITS Plus NGS Library Prep Kit, Microbiomics, 24 Reactions/Unit
Microbiomics
24 Reactions/Unit
Brand: Zymo Research- The most streamlined NGS kit with only 30 minutes of hands-on time for 96 samples
- 100% automation ready with only a single PCR step and without the need for normalization
- Real-time PCR enables absolute microbial copy number quantification
Size
$481.00
Login To Access Your Institutional Price
Microbiomics
24 Reactions/Unit
Brand: Zymo Research- The most streamlined NGS kit with only 30 minutes of hands-on time for 96 samples
- 100% automation ready with only a single PCR step and without the need for normalization
- Real-time PCR enables absolute microbial copy number quantification
The Quick-ITS Plus NGS Library Prep Kit is the fastest and simplest NGS library prep targeting the ITS region for high-throughput sequencing. The automation-friendly protocol utilizes a single qPCR/PCR for combined targeted amplification and barcode addition using specially designed primers. After pooling by equal volume, a single clean-up of the final library is performed, rather than massive AMPure® bead-based clean-ups. Additional library quantification analysis such as TapeStation® analysis or gel electrophoresis are not necessary. With these features, the workflow dramatically reduces the hands-on time of library preparation to only 30 minutes.
Amplicon Size | ~480bp |
---|---|
ITS Primer Sequences | ITS3f (GCATCGATGAAGAACGCAGC, 20 bp), ITS4r (TCCTCCGCTTATTGATATGC, 20 bp) adapters not included |
Sample Input | Purified microbial DNA ?100 ng, free of PCR inhibitors. |
Sequencing Platform | Illumina MiSeq® no need for custom sequencing primers, recommended MiSeq® Reagent Kit v3 (600-cycle) |
Storage Condition | -20C and 4C |
Purified total DNA from any organism free from PCR inhibitors. This system has been used by Zymo Researchs Microbiomics Services team to process samples from human, water, soil, food, plants, feces, biofilms, and much more.
The system has been tested with inputs as low as 100 femtograms with no significant impact to the performance of the kit.
This single PCR step combines targeted amplification of the microbial genome and the barcoding index PCR, which allows for a simple and fast workflow.
The combination of using Equalase qPCR Premix to yield roughly equal amounts of libraries and a carefully curated barcode index list results in similar raw sequencing reads across samples.
The ZymoBIOMICS Microbial Community DNA Standard consists of purified DNA from 8 bacteria and 2 yeasts and is useful for assessing community profile bias. The ZymoBIOMICS 16S/ITS qPCR Standard consists of a plasmid that has a single bacterial and single fungal target and is useful for quantifying copy number. Both are useful as positive controls for the library prep process.
Equalase amplification and the library prep design may cause some library products to not anneal well, causing a lack of a tight band. These libraries are perfectly fine because preparation for Illumina sequencing includes denaturing libraries into single strands.
Enjoy our products? Leave a review and let us know.